Some close friends of ours have a young child with a
malignant brain tumor. Needless to say we were all shocked and
disturbed to find out the news. The child is only 2 years old and
has a tumor 8 centimetres in size on the left side of his head.
When they tried to operate to remove it, they were only able to get
a little bit because he was bleeding too much. The pathology report
showed 20% primitive and 80% differential cells. The doctors are not
very optimistic. They are going to be treating him with chemo, to
try and shrink the tumor and operate again. Nobody knew anthing was
wrong until a week ago when he had a slight tremor in his right
hand. Otherwise he is not showing any other symptoms. They are
going to follow the treatment protocol from John’s Hopkins
hospital. He is presently at the Montreal Childrens hospital and
seems to be getting good care. Any bit of positive information
that anyone might have would be helpful, which I would pass on to
the parents.
–
Uucp: …{gatech,ames,rutgers}!ncar!asuvax!stjhmc!167!99.0!Fred.Blauer
Internet: Fred.Bla…@p0.f99.n167.z1.fidonet.org
In article <18385.264F0…@stjhmc.fidonet.org> Mike.We…@f10.n130.z1.fidonet.org (Mike Welch) writes:
>I noticed an article advertising EPHEDRINE HCL as a decongestant. It is sold
>through the mail and is very inexpensive. Does it work?
It does work but has a significant potential for rebound congestion meaning
when it wears off you will be more congested than when you started. It is
also a fairly strong stimulant (more than caffeine, less than amphetamine).
This may be considered an unpleasant side effect. It may not.
>I know that HLC is the base component, so my question relates to the ephedrine.
Actually, ephedrine is the "base" component and HCl is the "acid" component..
—————————————————————————
TTGATTGCTAAACACTGGGCGGCGAATCAGGGTTGGGATCTGAACAAAGACGGTCAGATTCAGTTCGTACTGCTG
Eric E. Snyder
Department of Biochemistry Oh, Noah, won’t yah open da door!
University of Colorado, Boulder
Boulder, Colorado 80309-0215
LeuIleAlaLysHisTrpAlaAlaAsnGlnGlyTrpAspLeuAsnLysAspGlyGlnIleGlnPheValLeuLeu
—————————————————————————
In article <21…@boulder.Colorado.EDU> eesny…@boulder.Colorado.EDU (Eric E. Snyder) writes:
>In article <18385.264F0…@stjhmc.fidonet.org> Mike.We…@f10.n130.z1.fidonet.org (Mike Welch) writes:
>>I noticed an article advertising EPHEDRINE HCL as a decongestant. It is sold
>>through the mail and is very inexpensive. Does it work?
>It does work but has a significant potential for rebound congestion meaning
>when it wears off you will be more congested than when you started. It is
>also a fairly strong stimulant (more than caffeine, less than amphetamine).
>This may be considered an unpleasant side effect. It may not.
Ephedrine is a powerful sympathomimetic drug (a precursor to
epinephrine, he said nervously, daunted by the wizardry of this group’s
usual readers). It causes smooth muscle to contract, making for heart
palpitations, increased blood pressure and, in large enough doses,
urinary retention. I am a quadriplegic and my blood pressure goes down
to 60/40 or lower on occasion. Ephedrine 10 mg. zaps it right back up
there in an hour of two for a good heart-thumping three or four hours.
Yes, there is a rebound effect (like any autonomic stimulant). It is also
possible to develop a sort of dependence on the drug. As someone who has
had the unfortunate pleasure of knowing ephedrine, leave it alone unless
you are having an asthmatic emergency on a desert island and have nothing
else.
———————————————————————
Warren Tucker, TuckerWare gatech!n4hgf!wht or wht%n4…@gatech.edu
Ker-au’-lo-phon. An 8-foot partial flue-stop, having metal pipes
surmounted by adjustable rings, and with a hole bored near the top of
each pipe. Tone soft and "reedy". – Pronouncing Pocket-Manual of
Musical Terms together with the Elements of Notation and Biographical
Dates of Noteworthy Musicians, G. Schirmer, Inc. New York (C) 1933.
In article <18385.264F0…@stjhmc.fidonet.org> Mike.We…@f10.n130.z1.fidonet.org (Mike Welch) writes:
>I noticed an article advertising EPHEDRINE HCL as a decongestant. It is sold
>through the mail and is very inexpensive. Does it work?
Decongestant not too good, but is used commonly as a bronchodilator for
asthma.
>I talked to my pharmacist about it, and he said that it used to be prescribed,
>but he rarely gets any calls for it any more.
Probably because it is so inexpensive through mail orders as a pseudo
amphetamine. If your intrigued, use caution, it can cause racing heart
rates if abused.
>I know that HLC is the base component, so my question relates to the ephedrine.
I don’t think you know this. HCl indicates that it is the hydrochloride
salt, which is acidic. The ephedrine is the basic component.
Your question, "Does it work?" Yes, but what’s your point?
Ephedrine is isolated from stems and leaves of the ephedra plant (Ma
Huang). The Chinese have been using it for 4000 years, so it probably
does work. I drink a tea of ephedra leaves occationally to remedy
bronchitis.
–
Steve Dukas (208)526-3447/{!(bigtex,uunet)!pmafire!dukas or du…@pmafire.UUCP}
******************************************************************************
…………..With a rose, in and out of the garden he goes……………….
In article <1990May15.192907.18…@pmafire.UUCP>, du…@pmafire.UUCP (Steve Dukas) writes:
> In article <18385.264F0…@stjhmc.fidonet.org> Mike.We…@f10.n130.z1.fidonet.org (Mike Welch) writes:
> >I noticed an article advertising EPHEDRINE HCL as a decongestant. It is sold
> >through the mail and is very inexpensive. Does it work?
> Decongestant not too good, but is used commonly as a bronchodilator for
> asthma.
Next question. What’s Pseudoephedrine HCl? Goes under the brand
name of Sudafed and is quite an effective decongestant, without
the side effects mentioned previously [at least for me -- I use
it against hay fever, which is what it's sold for].
—
–Andrew Koenig
a…@europa.att.com
In article <21…@boulder.Colorado.EDU> eesny…@boulder.Colorado.EDU (Eric E. Snyder) writes:
>>I noticed an article advertising EPHEDRINE HCL as a decongestant. It is sold
>>through the mail and is very inexpensive. Does it work?
>It does work but has a significant potential for rebound congestion meaning
>when it wears off you will be more congested than when you started. It is
>also a fairly strong stimulant (more than caffeine, less than amphetamine).
>This may be considered an unpleasant side effect. It may not.
I think you are confusing topical ephedrine with oral ephedrine. When
administered topically (i.e., in the form of nasal drops or spray),
ephedrine can cause rebound congestion if used excessively (although
less than with more potent sympathomimetics like oxymetazoline,
phenylephrine and xylometazoline) but does not cause CNS stimulation.
Orally, however, ephedrine causes CNS stimulation (to a greater extent
than pseudoephedrine or other OTC oral nasal decongestants) but, like
other oral agents, does not cause rebound congestion.
Topical sympathomimetics are effective nasal decongestants. The oral
agents, however, are of doubtful value.
–
Gerry Macridis, PO Box 3929, Wellington, NEW ZEALAND
Phone: +64 4 899444 … Mail: ge…@actrix.co.nz
- Hide quoted text — Show quoted text -
In article <6…@n4hgf.uucp> w…@n4hgf.UUCP (Warren Tucker) writes:
>Ephedrine is a powerful sympathomimetic drug (a precursor to
>epinephrine, he said nervously, daunted by the wizardry of this group’s
>usual readers). It causes smooth muscle to contract, making for heart
>palpitations, increased blood pressure and, in large enough doses,
>urinary retention. I am a quadriplegic and my blood pressure goes down
>to 60/40 or lower on occasion. Ephedrine 10 mg. zaps it right back up
>there in an hour of two for a good heart-thumping three or four hours.
>Yes, there is a rebound effect (like any autonomic stimulant). It is also
>possible to develop a sort of dependence on the drug. As someone who has
>had the unfortunate pleasure of knowing ephedrine, leave it alone unless
>you are having an asthmatic emergency on a desert island and have nothing
>else.
You should realize that since you probably have denervation supersensitivity,
the dose that produces a response in you would probably have less effect
on someone who has normal sympathetic innervation. I have taken
Ephedrine, 25mg in an experiment on myself to see if I can notice the
effect on metabolism that has been reported in mice. My pulse is perhaps
up to 70 or so after a dose, (normally below 60), but there are
no palpitations and no rise in BP. Ephedrine is safe enough to be
in over the counter asthma medicine in like doses.
Re: ephedrine HCL
I recently noticed that a Seven-Eleven store in my neighborhood is
selling ephedrine HCL from its counter, near where *cigarette* papers
are sold. A sign advertises it as a good source of energy. Does
this indicate that it is becoming a legally available drug of abust?
sorry, that last word should read *abuse* (trouble with my
editor:
;
:
:
Andy Goldfinger
Ephedrine and pseudoephidrine work by virtue of their properties as
adrenergic agonists – they stimulate the little arteries supplying the
nasal mucosa to constrict, thus reducing blood flow and fluid exudation
from these same vessels. I think they may also have other effects that
reduce the edema and congestion. BTW, because they constrict blood vessels,
anyone with high blood pressure should NOT be taking these medications.
l-Ephedrine and d-pseudoephedrine are stereoisomers. There are two chiral
carbons in the ephedrine molecule, yielding four possible isomers.
–
Steve Dyer
d…@ursa-major.spdcc.com aka {ima,harvard,rayssd,linus,m2c}!spdcc!dyer
d…@arktouros.mit.edu, d…@hstbme.mit.edu
In article <10…@alice.UUCP> a…@alice.UUCP (Andrew Koenig) writes:
>Next question. What’s Pseudoephedrine HCl?
I believe it’s the stereo-isomer of Ephedrine HCl. I think they
use that instead of Ephedrine to lower the abuse potential.
Isn’t there some theory about various receptor sites being able
to distinguish between left and right handedness of molecules?
Boyd Roberts b…@necisa.ho.necisa.oz.au
“When the going gets wierd, the weird turn pro…”
In article <1…@necisa.ho.necisa.oz> b…@necisa.ho.necisa.oz (Boyd Roberts) writes:
>I believe it’s the stereo-isomer of Ephedrine HCl. I think they
>use that instead of Ephedrine to lower the abuse potential.
What abuse potential?
In article <1…@necisa.ho.necisa.oz> b…@necisa.ho.necisa.oz (Boyd Roberts) writes:
>>Next question. What’s Pseudoephedrine HCl?
>I believe it’s the stereo-isomer of Ephedrine HCl. I think they
>use that instead of Ephedrine to lower the abuse potential.
No, they use it because it causes fewer side effects for a given amount
of "nasal decongestion" (not that that can be easily quantified). Ephedrine
is a more potent and powerful bronchodilator than pseudoephedrine and so
it is preferentially used in asthma nostrums.
Ephedrine causes a bit of central nervous system stimulation, more than
the degree found with pseudoephedrine, but it would be wrong to characterize
it as having a significant "abuse potential". As an amphetamine-like stimulant
it’s decidedly second-rate. Its peripheral adrenergic side effects tend to
limit its ability to be abused.
–
Steve Dyer
d…@ursa-major.spdcc.com aka {ima,harvard,rayssd,linus,m2c}!spdcc!dyer
d…@arktouros.mit.edu, d…@hstbme.mit.edu
In article <1…@necisa.ho.necisa.oz> b…@necisa.ho.necisa.oz (Boyd Roberts) writes:
>I believe it’s the stereo-isomer of Ephedrine HCl. I think they
>use that instead of Ephedrine to lower the abuse potential.
>Isn’t there some theory about various receptor sites being able
>to distinguish between left and right handedness of molecules?
The concept of stereo-specificity is one of the foundations of modern
pharmacology. Stereospecificity is found in adrenergic receptors, morphine
receptors, and other neurotransmitters.